[From nobody Mon Mar  8 11:43:33 2004
Received: from mail.xysm.net ([61.187.16.203])
	by portal.open-bio.org (8.12.8/8.12.8) with SMTP id i287Yk9Q029729
	for <bioperl-guts-l@portal.open-bio.org>; Mon, 8 Mar 2004 02:34:55 -0500
Received: (qmail 26238 invoked by uid 511); 8 Mar 2004 07:29:06 -0000
Received: from zhangrf@xysm.net by mail.xysm.net by uid 0 with
	qmail-scanner-1.20 (clamscan: 0.67.  Clear:RC:0(202.197.81.213):. 
	Processed in 1.1118 secs); 08 Mar 2004 07:29:06 -0000
Received: from unknown (HELO xysm.net) (zhangrf@202.197.81.213)
	by 0 with SMTP; 8 Mar 2004 07:29:05 -0000
Message-ID: <404C208D.7060608@xysm.net>
Date: Mon, 08 Mar 2004 15:28:13 +0800
From: Ruifang <zhangrf@xysm.net>
User-Agent: Mozilla/5.0 (Windows; U; Windows NT 5.0; en-US;
	rv:1.4) Gecko/20030624 Netscape/7.1 (ax)
X-Accept-Language: en-us, en
MIME-Version: 1.0
To: bioperl-guts-l@portal.open-bio.org
Subject: a problem of RestrictionEnzyme
Content-Type: multipart/alternative;
	boundary="------------050809030905040008070105"
X-Spam-Status: No
X-Scanned-By: MIMEDefang 2.39

This is a multi-part message in MIME format...

--------------050809030905040008070105
Content-Type: text/plain; charset=us-ascii; format=flowed
Content-Transfer-Encoding: 7bit
Content-Disposition: inline

Dear,

I am a graduate student in National Lab of Medical Genetics of China.

I am using Bioperl Module: RestrictionEnzyme.pm and I have encountered a 
question about this code.

I found  the restriction enzymes could not recognize the DAN sequence 
which is reverse complement to the enzymes sequence.
For example, the enzyme: MnlI, the recognize sequence :CCTC, the DNA 
sequence: GTACTTTTAGAGGATGAAACCT
the DAN sequence include  GAGG , which is reverse complement to CCTC,  
and the MnlI should cut this sequence, but the code could not give this 
result.

May I could have answer from you soon!

Thanks!
Best Wishes!

Ruifang

--------------050809030905040008070105--
]